View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6971_low_17 (Length: 268)
Name: NF6971_low_17
Description: NF6971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6971_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 6e-83; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 36938408 - 36938253
Alignment:
| Q |
1 |
atgtaggatcccatgtattgacaaatgtatcaaattccacagccacaaagggattttcttttgtgtaatttggagtagctaattgaacgctgctcatgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36938408 |
atgtaggatcccatgtattgacaaatgtatcaaattccacagccacaaagggattttcttttgtgtaatttggagtagctaattgaacgctgctcatgag |
36938309 |
T |
|
| Q |
101 |
accaataccacttccatctcttggaacaggtagtggaaaattggggtgtgccaaat |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36938308 |
accaataccacttccatctcttggaacaggtagtggaaaattggggtgtgccaaat |
36938253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 4 - 119
Target Start/End: Complemental strand, 36948649 - 36948534
Alignment:
| Q |
4 |
taggatcccatgtattgacaaatgtatcaaattccacagccacaaagggattttcttttgtgtaatttggagtagctaattgaacgctgctcatgagacc |
103 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||| ||||| |||||||||||||||||||||||| || |||||||| | |||| ||||| |
|
|
| T |
36948649 |
taggatcccagtcattaacaaatgtatcaaattccacagctacaaatggattttcttttgtgtaatttggattactcaattgaacacggctcgctagacc |
36948550 |
T |
|
| Q |
104 |
aataccacttccatct |
119 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
36948549 |
gataccacttccatct |
36948534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 4 - 74
Target Start/End: Complemental strand, 36958783 - 36958713
Alignment:
| Q |
4 |
taggatcccatgtattgacaaatgtatcaaattccacagccacaaagggattttcttttgtgtaatttgga |
74 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||| ||||| ||||||||||||||||||| |||| |
|
|
| T |
36958783 |
taggatcccattcattaacaaatgtatcaaattccacagctacaaatggattttcttttgtgtaatctgga |
36958713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University