View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6971_low_25 (Length: 232)
Name: NF6971_low_25
Description: NF6971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6971_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 25 - 215
Target Start/End: Original strand, 8465308 - 8465498
Alignment:
| Q |
25 |
aagaagtaaaatgaaacaaaatcttagaagtttaacttaaatcttggggtatcaaattattaaggtaagagactattatgagttgtctttgatctggatg |
124 |
Q |
| |
|
||||| ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
8465308 |
aagaactaaaatgaaacgaagtcttagaagtttaacttaaatcttggggtatcaaattattaaggtaggatactattatgagttgtctttgatctggatg |
8465407 |
T |
|
| Q |
125 |
ttaaacctacagtaaaataggagagaatgaaatcaaaatattaaagagagagttacctgagcttgtttcttcaactagctaagtctgtctg |
215 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8465408 |
ttaaacctacagcaaaataggagagaatgaaatcaaaatattaaagagagagttacctgagcttgtttcttcaactagctaagtctgtctg |
8465498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University