View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6971_low_28 (Length: 205)
Name: NF6971_low_28
Description: NF6971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6971_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 4e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 20 - 191
Target Start/End: Original strand, 22078338 - 22078509
Alignment:
| Q |
20 |
tcattaacttatagtcttatgctaacttttaactaactaactacatttgaatgatatgcttggtattcgtcaagcttgtctcatgttctacgatccatca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| || | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22078338 |
tcattaacttatagtcttatgctaacttttagcttattaactacatttgaatgatatgcttggtattcgtcaagcttgtctcatgttctacgatccatca |
22078437 |
T |
 |
| Q |
120 |
atatttctatttgtctttatagtataaatatgtcttcactagttgttttaaattaatgcaaatgagtattat |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22078438 |
atatttctatttgtctttatagtataaatatgtcttcaccagttgttttaaattaatgcaaatgagtattat |
22078509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 22058049 - 22058097
Alignment:
| Q |
38 |
atgctaacttttaactaactaactacatttgaatgatatgcttggtattc |
87 |
Q |
| |
|
||||||||||| | || |||||||||||||||||||||||||||| |||| |
|
|
| T |
22058049 |
atgctaacttt-atcttactaactacatttgaatgatatgcttggcattc |
22058097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University