View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6972_high_4 (Length: 259)
Name: NF6972_high_4
Description: NF6972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6972_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 12 - 226
Target Start/End: Complemental strand, 44922937 - 44922723
Alignment:
| Q |
12 |
catcaactatgatcttgacaccctccactcccatgtcgtttccatcaactacacgacccccgacagaaaatccagttacctgtaacagttaacattgata |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44922937 |
catcaactatgatcttgacaccctccactcccatgtcgtttccatcaactacacgacccccgacagaaaatccagttacctgtaacagttaacattgata |
44922838 |
T |
 |
| Q |
112 |
actattaaccagcatacatgtttcaacattaatagaaaaattacagtaaaatatgataattattaatgcaccgaacatgtttcaacatattaaatcttta |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44922837 |
actattaactagcatacatgtttcaacattaatagaaaaattacagtaaaatatgataattattaatgcaccgaacatgtttcaacatattaaatcttta |
44922738 |
T |
 |
| Q |
212 |
taaatgttcaatcag |
226 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
44922737 |
taaatgttcaatcag |
44922723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University