View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6972_high_8 (Length: 240)
Name: NF6972_high_8
Description: NF6972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6972_high_8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 54 - 240
Target Start/End: Complemental strand, 2603040 - 2602846
Alignment:
| Q |
54 |
tcagcacaaatgattcatatataatgtgctaagtgtgacttaaaatctcatcacacgtataaaagtgatagttgaaaaatttgaattttttagtacgcct |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |||||||||||| |||| |
|
|
| T |
2603040 |
tcagcacaaatgattcatatataatgtgctaagtgtgacttaaaatctcatcacgcgtataaaagagatagttgaaaaatttaaattttttagtaggcct |
2602941 |
T |
|
| Q |
154 |
ttg--------ccccacccatgaggcggagcagatgcaaggcaagtggcaattgttgtttcgtttctgcctcaaccgcaagatggataggtccat |
240 |
Q |
| |
|
|| |||| ||||||||||||||||||||| ||||||||| ||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
2602940 |
ctgccccccccccccccccatgaggcggagcagatgcgaggcaagtgacaattgttgtttcatttctgcctcaaccgcaagatggctaggtccat |
2602846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University