View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6972_low_9 (Length: 259)

Name: NF6972_low_9
Description: NF6972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6972_low_9
NF6972_low_9
[»] chr7 (1 HSPs)
chr7 (12-226)||(44922723-44922937)


Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 12 - 226
Target Start/End: Complemental strand, 44922937 - 44922723
Alignment:
12 catcaactatgatcttgacaccctccactcccatgtcgtttccatcaactacacgacccccgacagaaaatccagttacctgtaacagttaacattgata 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44922937 catcaactatgatcttgacaccctccactcccatgtcgtttccatcaactacacgacccccgacagaaaatccagttacctgtaacagttaacattgata 44922838  T
112 actattaaccagcatacatgtttcaacattaatagaaaaattacagtaaaatatgataattattaatgcaccgaacatgtttcaacatattaaatcttta 211  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44922837 actattaactagcatacatgtttcaacattaatagaaaaattacagtaaaatatgataattattaatgcaccgaacatgtttcaacatattaaatcttta 44922738  T
212 taaatgttcaatcag 226  Q
    |||||||||||||||    
44922737 taaatgttcaatcag 44922723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University