View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6973_low_13 (Length: 592)
Name: NF6973_low_13
Description: NF6973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6973_low_13 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 59; Significance: 1e-24; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 448 - 566
Target Start/End: Original strand, 24015 - 24134
Alignment:
| Q |
448 |
tgttattttttctggattgnnnnnnnattgatacaattattcattttgaaaccaggtactgaagctgcaaccaggaacaagggagcatatgcttcta-ct |
546 |
Q |
| |
|
||||||||||||||||||| |||||||| | ||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| || |
|
|
| T |
24015 |
tgttattttttctggattgcttgtttgttgatacattgattcattttgaaaccaggtactgaagctgcacccaggaacaagggagcagctgcttctacct |
24114 |
T |
 |
| Q |
547 |
aagtctttggaactttgctt |
566 |
Q |
| |
|
||||||| ||||| |||||| |
|
|
| T |
24115 |
aagtcttcggaacgttgctt |
24134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University