View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6973_low_46 (Length: 364)
Name: NF6973_low_46
Description: NF6973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6973_low_46 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 32 - 345
Target Start/End: Original strand, 25013582 - 25013889
Alignment:
| Q |
32 |
cacttaagtcggtaaatgaacaaagaggtaagattttagtgtagaaagattgtgtaccatgtattgtcatagaaaaaggtatttatatggtactaagggc |
131 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
25013582 |
cacttcagtcggtaaatgaacaaagaggtaagattttagtgtagaaagattgtgtaccgtgtattatcatataaaaaggtatttatatggtactaagggc |
25013681 |
T |
|
| Q |
132 |
acaaacaatcttatggttattgttatggacggtattctcatgaaaacctttgaattatgtgcagtattcatggacggtattcatgtgctaatattgtgtt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| || ||||||||||||||||| |
|
|
| T |
25013682 |
acaaacaatcttatggttattgttatggacggtattctcatgaaaacctttgaattatgtacagcattcatggac---at---tgtgctaatattgtgtt |
25013775 |
T |
|
| Q |
232 |
tggtataactgtattttatggttttttgccgtcaaattttcatttcaagtgctgcgaacctgtcgtgacatctgcgattctgctctgccacaccgcgtct |
331 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
25013776 |
tggtataattgtattttatggttttttgccgtcaaattttcatttcaagtgctgcaaacctgtcgtgacatctgcaattctgctctgccacaccgcatct |
25013875 |
T |
|
| Q |
332 |
cggggcggttactt |
345 |
Q |
| |
|
||||||||||||| |
|
|
| T |
25013876 |
gggggcggttactt |
25013889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University