View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6973_low_54 (Length: 338)
Name: NF6973_low_54
Description: NF6973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6973_low_54 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 323
Target Start/End: Complemental strand, 2730787 - 2730465
Alignment:
| Q |
1 |
atggtctcgagagagagtggcaaggaggagaagagtatggcttcaagtgtttggaatcccccttcatgcatgagaggaagggttcttcaagcttcttgat |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2730787 |
atggtctcgagagaaagtggcaaggaggagaagagtatggcttcaagtgtttggaatcccccttcatgcatgagaggaagggttcttcaaccttcttgat |
2730688 |
T |
|
| Q |
101 |
tcaaagttcagtgaattcatagattttacggtgatacaattcaaaggaaccatctagatgtggcatagatcctagtgtttttctcttaaaacggggttga |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
2730687 |
tcaaagttcagagaattcatagattttacagtgatacaattcaaaggaaccatctagatgtggcatagatcctagtgtttttctcttaaaatggggttaa |
2730588 |
T |
|
| Q |
201 |
taggtggatctttcaccatttcaattgtaggtaaaaggtacaagatatgggtgaaggaagaagatttacggtggatgaatgggcggaggaacaacggtga |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2730587 |
taggtggatctttcaccatttcaattgtaggtataaggtacaagatatgggtgaaggaagaagatttacggtggatgaatgggcggaggaacaacagtga |
2730488 |
T |
|
| Q |
301 |
aggtagttcgattgagggtgatg |
323 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2730487 |
aggtagttcgattgagggtgatg |
2730465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University