View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6973_low_61 (Length: 320)
Name: NF6973_low_61
Description: NF6973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6973_low_61 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 2 - 267
Target Start/End: Original strand, 32649909 - 32650174
Alignment:
| Q |
2 |
ccaaaaagagcaactatcaaagtgaggggcaacatctaaagagaataaaaaatagataggaggagcaaccaaagagacaaatcatagtagattcaacact |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32649909 |
ccaaaaagagcaactatcaaagtgaggggcaacaactaaagagaataaaaaatagataggaggagcaaccaaagagacaaatcatagtagattcaacact |
32650008 |
T |
 |
| Q |
102 |
aactatattattaatactttaatttatttattagagaaatgaaagcaattattgggatatttgacacaatatatttatacaatttccagatgctttttaa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32650009 |
aactatattattaatactttaatttatttattagagaaatgaaagcaattattgggatatttgacacaatatatttatacaatttccaggtgctttttaa |
32650108 |
T |
 |
| Q |
202 |
tattccagatatttggtccatgtgtgatatttagtccaggtgtggatcagattgaacaataatgcc |
267 |
Q |
| |
|
|||| | |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32650109 |
tatttctgatatttggtccatgtgtgatatttagtccaggtgtggattagattgaacaataatgcc |
32650174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University