View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6973_low_68 (Length: 301)
Name: NF6973_low_68
Description: NF6973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6973_low_68 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 9 - 288
Target Start/End: Original strand, 38285516 - 38285797
Alignment:
| Q |
9 |
gagatggacatcatgcagatcagtgagaagtttgatagactagataccggaaactgtggaaaaataacacttggtgatctcatggagggtcatagttgat |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38285516 |
gagaaggacatcatgcagatcagtgagaagtttgatagactagataccggaaactgtggaaaaataacacttggtgatctcatggagggtcatagttgat |
38285615 |
T |
|
| Q |
109 |
gagcttgatcagcatcggggctatccaaggagcaaggggagtctaaatccattgttgtcacataaaaatgggactgccagatcctcaagttgcatgctga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38285616 |
gagcttgatcagcatcggggctatccaaggagcaaggggagtctaaatccattgttgtcacataaaaatgggactgccagatcctcaagttgcatgctga |
38285715 |
T |
|
| Q |
209 |
ttagtgtagaccacatttgatggaaactttttc--ttgagggttaggaaggataatagattatcaagtaacatactggtgat |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38285716 |
ttagtgtagaccacatttgatggaaactttttcttttgagggttaggaaggataatagattatcaagtaacatactggtgat |
38285797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University