View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6973_low_71 (Length: 286)

Name: NF6973_low_71
Description: NF6973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6973_low_71
NF6973_low_71
[»] chr1 (1 HSPs)
chr1 (1-185)||(28850169-28850353)
[»] chr3 (1 HSPs)
chr3 (137-226)||(21311110-21311199)


Alignment Details
Target: chr1 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 28850353 - 28850169
Alignment:
1 tcactgcatgtaaatgacggcactgttcatcatcaccccaaataaaacctctttgcaacttctgaatctcatgaagatacgatttaggaataacacaact 100  Q
    |||||||||||||||| |||| ||||||||| ||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||||||||    
28850353 tcactgcatgtaaatgtcggcgctgttcatcctcaccccaaataaaatctctttgcaacttctgaatctcataaagacacgatttaggaataacacaact 28850254  T
101 catcatcggataaataggaactgcttcaataaatgatttagcaaaagtcactctaccagcaaaggaaagatgttttgctttccat 185  Q
    ||||||||||||||||  |||||||||||||| ||||||||||| |||||||| |||  |||||||||||||||||||| |||||    
28850253 catcatcggataaataaaaactgcttcaataactgatttagcaagagtcactcaaccgacaaaggaaagatgttttgctatccat 28850169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 137 - 226
Target Start/End: Original strand, 21311110 - 21311199
Alignment:
137 tttagcaaaagtcactctaccagcaaaggaaagatgttttgctttccatgacaccagtttatttctcacttgatcaataatatactgaaa 226  Q
    |||||| ||||| ||||| || | ||||||||| ||||| |||||||| | ||  || ||||| || |||||||||| ||||||||||||    
21311110 tttagccaaagtaactctccctggaaaggaaagttgtttagctttccaggccataagcttattgctgacttgatcaacaatatactgaaa 21311199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University