View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6973_low_77 (Length: 268)
Name: NF6973_low_77
Description: NF6973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6973_low_77 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 13 - 257
Target Start/End: Complemental strand, 40557481 - 40557237
Alignment:
| Q |
13 |
atcaatgaagtaaacgaagtctaaagtctaaatacttaaaattaaagattttatatgaaagtatgtgcatcattgactaatagaacttggctagagcttg |
112 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40557481 |
atcaatgaagcaaacgaagtcaaaagtctaaatacttaaaattaaagattttatatgaaagtatgtgcatcattgactgatagaacttggctagagcttg |
40557382 |
T |
 |
| Q |
113 |
acgagtgcgaagtagagttcaccacggcatctaaaagaccagagttgcacctttttcttggctttgaaacggttttctgctacaagttcgttccatttgt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40557381 |
acgagtgcgaagtagagttcaccacggcatctaaaagaccaaagttgcacctttttcttggctttgaaacggttttctgctacaagttcgttccatttgt |
40557282 |
T |
 |
| Q |
213 |
ttgtgataatgtagacctctccagtcaccattttccacttcttga |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40557281 |
ttgtgataatgtagacctctccagtcaccattttccacttcttga |
40557237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University