View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6973_low_84 (Length: 243)
Name: NF6973_low_84
Description: NF6973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6973_low_84 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 12 - 243
Target Start/End: Complemental strand, 35842081 - 35841850
Alignment:
| Q |
12 |
acatcacctacagaagaacttccataacaggacttgccattatcaagatctccacctctctgactgtctttacaatcggtagcaattgttgggtgcagaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35842081 |
acatcacctacagaagaacttccataacaggacttgccattatcaagatctccacctctctgactgtctttacaatcggtagcaattgttgggtgcagaa |
35841982 |
T |
 |
| Q |
112 |
catttgattcttctgaaggctttagatcttcatcatctgctgttgtttcctgatagggagacaaatccatcggagaaaagccaccagaagattcaggggt |
211 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35841981 |
catttgattcttctgaagcctttagatcttcatcatctgctgttgtttcctgatagggagacaaatccatcggagaaaagccaccagaagattcaggggt |
35841882 |
T |
 |
| Q |
212 |
ttcaagtgaactgttttcttttggcaaatgat |
243 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |
|
|
| T |
35841881 |
ttcaagcgaactgttttcttttggcaaatgat |
35841850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University