View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6973_low_92 (Length: 223)
Name: NF6973_low_92
Description: NF6973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6973_low_92 |
 | |
|
| [»] scaffold0790 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0790 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: scaffold0790
Description:
Target: scaffold0790; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 14 - 73
Target Start/End: Original strand, 265 - 324
Alignment:
| Q |
14 |
ttggtggtgaatatgtggaacggtggaaaggtttctttcaaagtcactctcacttccgat |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
265 |
ttggtggtgaatatgtggaacggtggaaaggtttatttcaaactcactctcacttccgat |
324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 14 - 61
Target Start/End: Complemental strand, 33986035 - 33985988
Alignment:
| Q |
14 |
ttggtggtgaatatgtggaacggtggaaaggtttctttcaaagtcact |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33986035 |
ttggtggtgaatatgtggaacggtggaaaggtttctttcaaagtcact |
33985988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 14 - 77
Target Start/End: Original strand, 24428216 - 24428282
Alignment:
| Q |
14 |
ttggtggtgaatatgtggaacggtg---gaaaggtttctttcaaagtcactctcacttccgatccaa |
77 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24428216 |
ttggtggtgaatatggcgaacggtggtggaaaggtttctttcaaagtcactctcacttccgatccaa |
24428282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University