View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6973_low_95 (Length: 208)
Name: NF6973_low_95
Description: NF6973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6973_low_95 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 8e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 27 - 195
Target Start/End: Original strand, 8641750 - 8641918
Alignment:
| Q |
27 |
tctgcagaaagcatacataaaaggaccagcgcctcagaaagaagctgctcctggtcttgcatactttcacatccccttgccggaatatacaagttttgat |
126 |
Q |
| |
|
||||||||| ||||| ||||||||||| ||||| || ||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||| |
|
|
| T |
8641750 |
tctgcagaatgcatatataaaaggaccggcgccacaaaaagaagctgctcctggtcttgcatactttcacatccccttaccggaatatgcaagtcttgat |
8641849 |
T |
|
| Q |
127 |
tcatcaaacatgacaggtgtgaaaatggaaacggatggcggtgatggcattagttctgcttcagtgaac |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||||||||||| || |||||| |
|
|
| T |
8641850 |
tcatcaaacatgacaggtgtgaaaatggaaacatatagcggtgatggcattagttctgcgtcggtgaac |
8641918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 27 - 195
Target Start/End: Original strand, 8648330 - 8648498
Alignment:
| Q |
27 |
tctgcagaaagcatacataaaaggaccagcgcctcagaaagaagctgctcctggtcttgcatactttcacatccccttgccggaatatacaagttttgat |
126 |
Q |
| |
|
||||||||| ||||| ||||||||||| ||||| || ||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||| |
|
|
| T |
8648330 |
tctgcagaatgcatatataaaaggaccggcgccacaaaaagaagctgctcctggtcttgcatactttcacatccccttaccggaatatgcaagtcttgat |
8648429 |
T |
|
| Q |
127 |
tcatcaaacatgacaggtgtgaaaatggaaacggatggcggtgatggcattagttctgcttcagtgaac |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||||||||||| || |||||| |
|
|
| T |
8648430 |
tcatcaaacatgacaggtgtgaaaatggaaacatatagcggtgatggcattagttctgcgtcggtgaac |
8648498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University