View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6974_low_3 (Length: 354)
Name: NF6974_low_3
Description: NF6974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6974_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 12 - 350
Target Start/End: Original strand, 55423511 - 55423849
Alignment:
| Q |
12 |
atggacatcaggccagaacgctgcaccactctcgtactcttgattataaacattgattatctgcaattggaagatatgagtcttcatcttgtatatggca |
111 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55423511 |
atggacatcaggccagaacgctgcgccactctcgtactcttgattataaacattgattatctgcaattggaagatatgagtcttcatcttgtatatggca |
55423610 |
T |
|
| Q |
112 |
acataaacagaggacccaaattctacaatcatacttgaccctgacatgcacaacataattcaaacatctcattacctgatggcggaacacaacataggcc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55423611 |
acataaacagaggacccaaattctacaatcatacttgaccctgacatgcacaacataattcaaacatctcattacctgatggcggaacacaacataggcc |
55423710 |
T |
|
| Q |
212 |
aacccgaagaaaattattatgaaaggaagaacagttggtgtcaccgcagcatagactagacccagcaaaaaatacaattgtatgcgaggttctccagtgt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55423711 |
aacccgaagaaaattattatgaaaggaagaacagttggtgtcactgcagcatagactagacccagcaaaaaatacaattgtatgcgaggttctccagtgt |
55423810 |
T |
|
| Q |
312 |
tgaaaccaatactcccgggattcatggcctcttccctgt |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55423811 |
tgaaaccaatactcccgggattcatggcctcttccctgt |
55423849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University