View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6974_low_4 (Length: 332)
Name: NF6974_low_4
Description: NF6974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6974_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 26 - 319
Target Start/End: Original strand, 43226565 - 43226858
Alignment:
| Q |
26 |
actcaagctccaatgccacaaaatcaccttgacttgctccaccatttcatcaactccacacaccttctcattgaaaattcgatcatttctcatcttctaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |||||| |||||||||||||| |
|
|
| T |
43226565 |
actcaagctccaatgccacaaaatcaccttgacttgctccaccatttcatcaactccacacaccttctcattaaatatgcgatcaattctcatcttctaa |
43226664 |
T |
|
| Q |
126 |
accacccacacgacggcgtgccaaattaaccaagcccctcgtctaagctttttagaccgcacctcactcatccaacaagtagcatgaataaacaaattgg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43226665 |
accacccacacgacggcgtgccaaattaaccaagcccctcgtctaagctttttagaccgcacctcactcatccaacaagtagcatgaataaacaaattgg |
43226764 |
T |
|
| Q |
226 |
gatgtgtgataaaactaaaattcagccacctcatcacctccgtccacacctttgaaatcactcgacaaagaagaaaaagatgattggccgtttc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43226765 |
gatgtgtgataaaactaaaattcagccacctcatcacctccgtccacaccttcgaaatcactcgacaatgaagaaaaagatgattggccgtttc |
43226858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 124 - 203
Target Start/End: Complemental strand, 15623223 - 15623144
Alignment:
| Q |
124 |
aaaccacccacacgacggcgtgccaaattaaccaagcccctcgtctaagctttttagaccgcacctcactcatccaacaa |
203 |
Q |
| |
|
|||||||||| | ||| || |||||||||||||| ||||||||||||||||||||||||| |||||| || |||||||| |
|
|
| T |
15623223 |
aaaccacccaaatgaccgcatgccaaattaaccacgcccctcgtctaagctttttagaccacacctcccttgtccaacaa |
15623144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 124 - 203
Target Start/End: Complemental strand, 15647012 - 15646933
Alignment:
| Q |
124 |
aaaccacccacacgacggcgtgccaaattaaccaagcccctcgtctaagctttttagaccgcacctcactcatccaacaa |
203 |
Q |
| |
|
|||||||||| | ||| || |||||||||||||| ||||||||||||||||||||||||| |||||| || |||||||| |
|
|
| T |
15647012 |
aaaccacccaaatgaccgcatgccaaattaaccacgcccctcgtctaagctttttagaccacacctcccttgtccaacaa |
15646933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 48 - 122
Target Start/End: Complemental strand, 16256842 - 16256768
Alignment:
| Q |
48 |
atcaccttgacttgctccaccatttcatcaactccacacaccttctcattgaaaattcgatcatttctcatcttc |
122 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||| || || | ||| |||| | |||||||||||||||| |
|
|
| T |
16256842 |
atcaccttgacttgatccaccatttcatcaaccccacaaactttgttattaaaaaccctatcatttctcatcttc |
16256768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 144 - 285
Target Start/End: Complemental strand, 655248 - 655107
Alignment:
| Q |
144 |
tgccaaattaaccaagcccctcgtctaagctttttagaccgcacctcactcatccaacaagtagcatgaataaacaaattgggatgtgtgataaaactaa |
243 |
Q |
| |
|
|||||||||||||| ||||| || |||||||| || |||| ||||| || ||||||| || ||||||| ||| || ||| | ||||||||| ||| |
|
|
| T |
655248 |
tgccaaattaaccacgccccgcgcctaagcttctttgaccaaacctccctagcccaacaaataacatgaatgaacgggtttggaggggtgataaaattaa |
655149 |
T |
|
| Q |
244 |
aattcagccacctcatcacctccgtccacacctttgaaatca |
285 |
Q |
| |
|
|||||| |||| |||| |||| | |||||||||| ||||||| |
|
|
| T |
655148 |
aattcaaccacttcattaccttcctccacaccttagaaatca |
655107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University