View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6974_low_7 (Length: 210)
Name: NF6974_low_7
Description: NF6974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6974_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 196
Target Start/End: Complemental strand, 4997540 - 4997361
Alignment:
| Q |
17 |
gatgcaagacacccttcatacagatgtgagattttggaattggagatgatgtattattatttttgattacatgatgaaattgggggataacacccaccat |
116 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4997540 |
gatgcaaggcacccttcatacagatgtgagattttggaattggagatgatgtattattatttttggttacatgatgaaattgggggataacacccaccat |
4997441 |
T |
 |
| Q |
117 |
gagagttcaaagactgatgtgtgggaaagaaagccatggatcttctacctttctcttccaatataatgaggtcaatatca |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4997440 |
gagagttcaaagactgatgtgtgggaaagaaagccatggatcttctacctttctcttccaatataatgaggtcaatatca |
4997361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 106 - 178
Target Start/End: Complemental strand, 44541818 - 44541746
Alignment:
| Q |
106 |
acacccaccatgagagttcaaagactgatgtgtgggaaagaaagccatggatcttctacctttctcttccaat |
178 |
Q |
| |
|
|||||||||| ||| ||||||| |||||||||||||||||||| | ||||||||||||||||| ||||||| |
|
|
| T |
44541818 |
acacccaccaagagtgttcaaaaactgatgtgtgggaaagaaaacggtggatcttctacctttcagttccaat |
44541746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 26 - 78
Target Start/End: Complemental strand, 44541917 - 44541865
Alignment:
| Q |
26 |
cacccttcatacagatgtgagattttggaattggagatgatgtattattattt |
78 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
44541917 |
cacccttcatagagatgtgagattttggaattggggatggtgtattattattt |
44541865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 26 - 78
Target Start/End: Original strand, 9362861 - 9362913
Alignment:
| Q |
26 |
cacccttcatacagatgtgagattttggaattggagatgatgtattattattt |
78 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
9362861 |
cacccttcatagagatgtgagattttggaattggggatggtgtattattattt |
9362913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 106 - 178
Target Start/End: Original strand, 9362960 - 9363032
Alignment:
| Q |
106 |
acacccaccatgagagttcaaagactgatgtgtgggaaagaaagccatggatcttctacctttctcttccaat |
178 |
Q |
| |
|
|||||||||| ||| ||||||| |||||||||||||||||||| | ||||||||||||||||| ||||||| |
|
|
| T |
9362960 |
acacccaccaagagtgttcaaaaactgatgtgtgggaaagaaaacggtggatcttctacctttcagttccaat |
9363032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University