View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6974_low_8 (Length: 209)
Name: NF6974_low_8
Description: NF6974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6974_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 117 - 195
Target Start/End: Complemental strand, 32196133 - 32196055
Alignment:
| Q |
117 |
tctgacggcaatgtttctggtagtgacagtgatttttctgatgatccacttgcggaggttgatttggataacattcttc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32196133 |
tctgacggcaatgtttctggtagtgacagtgatttttctgatgatccacttgcggaggttgatttggataacattcttc |
32196055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 17 - 53
Target Start/End: Complemental strand, 32196233 - 32196197
Alignment:
| Q |
17 |
aaaagggattatgcgagatgacaagggaaaagggaaa |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32196233 |
aaaagggattatgcgagatgacaagggaaaagggaaa |
32196197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University