View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6975_high_15 (Length: 324)

Name: NF6975_high_15
Description: NF6975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6975_high_15
NF6975_high_15
[»] chr5 (1 HSPs)
chr5 (119-299)||(16401724-16401904)


Alignment Details
Target: chr5 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 119 - 299
Target Start/End: Original strand, 16401724 - 16401904
Alignment:
119 ccataaattaaaaccacttagagaaattgatggtcataaacaaaagacttaataaacaaatggaattttctaatacctgataaaatttaatgattcacat 218  Q
    ||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
16401724 ccataaattaataccacttagagaaattgattgtcataaacaaaagacttaataaacaaatggaattttctaatacctgataaaatttaatgatccacat 16401823  T
219 gtgcgaaacttttaatatgtgtttcaaactataaagagctccctaggaaacctgcatcaacctcaaaatatcgaccaccgt 299  Q
     ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
16401824 ctgcaaaacttttaatatgtgtttcaaactataaagagctccctaggaaacctgcctcaacctcaaaatatcgaccaccgt 16401904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University