View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6975_low_28 (Length: 301)
Name: NF6975_low_28
Description: NF6975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6975_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 6 - 287
Target Start/End: Original strand, 33807838 - 33808119
Alignment:
| Q |
6 |
agatggacatcacaaatgcaatgtctaaaatataggacacgaggacaagatgcacacacacaaagatacaaaagggttataaaacatatcattcaaggtt |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33807838 |
agatggacacaacaaatgcaatgtctaaaatataggacacggggacaagatgcacacacacaaagatacaaaagggttataaagcatatcattcaaggtt |
33807937 |
T |
 |
| Q |
106 |
taacaaaacagctttgaaatagtgtgatgcttacccaatctacccttatcatgaatttgagaacttgtagctaacagcctcttgccttggttgatttttc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33807938 |
taacaaaacagctttgaaatagtgtgatgcttacccaagctacccttatcatgaatttgaggacttgtagctaacagcctcttgccttgattgatttttc |
33808037 |
T |
 |
| Q |
206 |
tgcaaaacacgtcaaaacggaaatcaaccaaattgttactttaagagacacgtatatttatgcactcaatgcccactgatgt |
287 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33808038 |
tgcaaaacacgtcaaaacagatatcaaccaaattgttactttaagagacacgtatatttatgcactcaatgcccactgatgt |
33808119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University