View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6975_low_30 (Length: 289)
Name: NF6975_low_30
Description: NF6975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6975_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 278
Target Start/End: Original strand, 39256779 - 39257055
Alignment:
| Q |
1 |
aaagaccttccctcctgttagggtgtcaaatgagagtaagaattttttacattggatgaaatgagggtgttgagcaacatataagcgagggacccatata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39256779 |
aaagaccttccctcctgttagggtgtcaaatgagagtaagaatttt-tacattggatgaaatgagggtgttgagcaacatataagcgagggacccatata |
39256877 |
T |
|
| Q |
101 |
cccaatgttttaaggttttgggtaagggtgttcacatccaaatgtggtccaaaaatactgcaaactg-nnnnnnngtgaatcttattggatgtttttgga |
199 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39256878 |
cccaatgttttaatgttttgggtaggggtgttcacatccaaatgtggtccaaaaatactgcaaactgaaaaaaaagtgaatcttattggatgtttttgga |
39256977 |
T |
|
| Q |
200 |
tcaaatgactttttgccgcaaaatcgatccgaactgattcgcaaacaccccctagttttgagtgtagatgtgatgtcca |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
39256978 |
tcaaatgactttttgccgcaaaatcgatccgaactgattcgcaaaca-cccctagttttgagtgtagatgtggtgtcca |
39257055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 193 - 249
Target Start/End: Original strand, 5987679 - 5987735
Alignment:
| Q |
193 |
ttttggatcaaatgactttttgccgcaaaatcgatccgaactgattcgcaaacaccc |
249 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||||| ||||| |||||||||||| |
|
|
| T |
5987679 |
ttttggatcaaatgacattttaccttaaaatcgatccaaactgtatcgcaaacaccc |
5987735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 67 - 122
Target Start/End: Original strand, 27603765 - 27603821
Alignment:
| Q |
67 |
gtgttgagcaacatataagcga-gggacccatatacccaatgttttaaggttttggg |
122 |
Q |
| |
|
||||||||||||||| |||||| |||| ||||||| | ||||| ||||||||||||| |
|
|
| T |
27603765 |
gtgttgagcaacatagaagcgaggggatccatatatctaatgtgttaaggttttggg |
27603821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 91 - 123
Target Start/End: Complemental strand, 21396204 - 21396172
Alignment:
| Q |
91 |
gacccatatacccaatgttttaaggttttgggt |
123 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
21396204 |
gacccatatacccaatgtcttaaggttttgggt |
21396172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University