View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6975_low_33 (Length: 275)

Name: NF6975_low_33
Description: NF6975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6975_low_33
NF6975_low_33
[»] chr4 (1 HSPs)
chr4 (1-263)||(28161516-28161778)


Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 28161778 - 28161516
Alignment:
1 ctgtatacatcggcaggttgagtttgtggccgttgaaaactgcggcactcgggtgctctatagaaaaaagaagtggcacttggttcctccattgtgtcgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28161778 ctgtatacatcggcaggttgagtttgtggccgttgaaaactgcggcactcgggtgctctatagaaaaaagaagtggcacttggttcctccattgtgtcgg 28161679  T
101 gattaaggaacacagtgagaccataatcagtgagacaggactcaaagtcggcaccaagtaacacattggaagatttcagatttccgtgagccatgccggg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
28161678 gattaaggaacacagtgagaccataatcagtgagacaggactcaaagtcggcaccaagtaacacattggaagatttcagatttccatgagccatgccggg 28161579  T
201 gttttggtggatatagagaaggcctgttgctagatcttctgcaattttaagacatgatgtcca 263  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28161578 gttttggtggatatagagaaggcctgttgctagatcttctgcaattttaagacatgatgtcca 28161516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University