View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6975_low_43 (Length: 231)
Name: NF6975_low_43
Description: NF6975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6975_low_43 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 28 - 109
Target Start/End: Complemental strand, 31832709 - 31832628
Alignment:
| Q |
28 |
tgatccaccaatccaatcctacccatcaaatcctcagcttcagttttcattcagaagactctttcacatcaccccattaaaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31832709 |
tgatccaccaatccaatcctacccatcaaatcctcagcttcagttttcattcagaagactctttcacatcaccccattaaaa |
31832628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 169 - 221
Target Start/End: Complemental strand, 31832568 - 31832516
Alignment:
| Q |
169 |
aactacaacaatacttgaactacgtggtgtcaagaacaatgatggtgatgatg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31832568 |
aactacaacaatacttgaactacgtggtgtcaagaacaatgatggtgatgatg |
31832516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University