View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6975_low_51 (Length: 206)

Name: NF6975_low_51
Description: NF6975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6975_low_51
NF6975_low_51
[»] chr1 (1 HSPs)
chr1 (12-194)||(8526843-8527025)


Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 12 - 194
Target Start/End: Original strand, 8526843 - 8527025
Alignment:
12 atggacatcatcttgatgcagatagaaaacgaggtatgtcacaattatcattgagattatgcttatgcggtggaccccatttatccaatgaatgccctat 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8526843 atggacatcatcttgatgcagatagaaaacgaggtatgtcacaattatcattgagattatgcttatgcggtggaccccatttatccaatgaatgccctat 8526942  T
112 gagagttgccagggcttgtttcctgaaaaaacaatattaaaaatttgctaaaagaaagaataagctctaatagtgatgtccat 194  Q
    ||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||    
8526943 gagagttgcgagagcttgtttcctgaaaaaacaatattaaaaatttgctaaaagaaagaataagctctaatagtaatgaccat 8527025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University