View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6976_high_10 (Length: 243)
Name: NF6976_high_10
Description: NF6976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6976_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 81 - 227
Target Start/End: Original strand, 46809694 - 46809840
Alignment:
| Q |
81 |
atccaaggcagatatatcatagtctaaggcaggaactgtaagcaaactgattcttctggataaccctttccatgaattgactaaaattgtctatagttaa |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46809694 |
atccaaggcagatatatcatagtctaaggcaggaactgtaagcaaactgattcttctggataaccctttccatgaattgactaaaattgtctataattaa |
46809793 |
T |
 |
| Q |
181 |
gctcagagacacacaaggataaggcatctttcacttgtatgttattg |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46809794 |
gctcagagacacacaaggataaggcatctttcacttgtatgttattg |
46809840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 46809621 - 46809673
Alignment:
| Q |
1 |
gaaactaggaaccgtagctcatttacgctgaaggccatctatgcaaatatact |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46809621 |
gaaactaggaaccgtagctcatttacgctgaaggccatctatgcaaatatact |
46809673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University