View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6976_low_13 (Length: 273)
Name: NF6976_low_13
Description: NF6976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6976_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 3388908 - 3388652
Alignment:
| Q |
1 |
ttctctcatgtggtctttgatgtcatccacaatgaatcccatgtcaaggatttgctcgttttggagcatgtcatcattgtatctaccaatacttggcagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3388908 |
ttctctcatgtggtctttgatgtcatccacaatgaatcccatgtcaaggatttgctcgttttggagcatgtcatcattgtatctaccaatacttggcagc |
3388809 |
T |
 |
| Q |
101 |
ctccaaaagcttcaaagtttttgtgtgtaatgtgttgtaaacagagcatattttaaaagttttaaatatattgtctgataattatacgggataaatatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3388808 |
ctccaaaagcttcaaagtttttgtgtgtaatgtgttgtaaacagagcatattttaaaagttttaaatatattgtctgataattatacgggataaatatga |
3388709 |
T |
 |
| Q |
201 |
aaacatgtttttattggnnnnnnntacattattttctccataatattgacttgatctt |
258 |
Q |
| |
|
||| ||||||||||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
3388708 |
aaagatgtttttattgg-aaaaaatacgttattttctccgtaatattgacttgatctt |
3388652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 11 - 77
Target Start/End: Original strand, 3320173 - 3320239
Alignment:
| Q |
11 |
tggtctttgatgtcatccacaatgaatcccatgtcaaggatttgctcgttttggagcatgtcatcat |
77 |
Q |
| |
|
||||||| | ||||||||| |||||||||||||||| ||||| |||| ||||||||||||| ||||| |
|
|
| T |
3320173 |
tggtcttgggtgtcatccaaaatgaatcccatgtcatggattagctcattttggagcatgttatcat |
3320239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University