View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6978_high_23 (Length: 353)
Name: NF6978_high_23
Description: NF6978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6978_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 201 - 338
Target Start/End: Original strand, 38128042 - 38128179
Alignment:
| Q |
201 |
agggggtttcaaccatctgtgttctgcggcatgttgaggttgattaggggccgtttgttgtaataatagccactcgtgcaaatagtcttttgccgccaat |
300 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| | ||| |
|
|
| T |
38128042 |
aggggttttcaaccatctgtgttctgcggtatgttgaggttgattaggggccgtctgttgtaataatagccactcgtgcaaataatcttttgctgtcaag |
38128141 |
T |
 |
| Q |
301 |
aggacgttggccgcagtaatcaacttattctcccacag |
338 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
38128142 |
aggacattggctgcagtaatcaacttattctcccacag |
38128179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University