View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6978_high_3 (Length: 861)
Name: NF6978_high_3
Description: NF6978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6978_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 352; Significance: 0; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 7 - 366
Target Start/End: Original strand, 29161589 - 29161948
Alignment:
| Q |
7 |
gttgccgaggttattggggaagcagttttttaagaagaggaagattccggttcaggtggatttgcagaagaagaattggaaggagcagattgagaaggct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29161589 |
gttgccgaggttattggggaagcagttttttaagaagaggaagattccggttcaggtggatttgcagaagaagaattggaaggagcagattgagaaggct |
29161688 |
T |
 |
| Q |
107 |
tgttcttctgcattgttgtttttgaggactgggacttgtagtgtggtgaaggtggctaagttgagtatggagagagatgagattgttgagaatgttgttg |
206 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29161689 |
tgttcttctgctttgttgtttttgaggactgggacttgtagtgtggtgaaggtggctaagttgagtatggagagagatgagattgttgagaatgttgttg |
29161788 |
T |
 |
| Q |
207 |
ctgcaatggagggtgttgtcgaggttttaccgaagaaatgggcggttgttaggtcttttcatgttaagttgttggagtctcttgctttaccggtttacca |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29161789 |
ctgcaatggagggtgttgtcgaggttttaccgaagaaatgggcggttgttaggtcttttcatgttaagttgttggagtctcttgctttaccggtttacca |
29161888 |
T |
 |
| Q |
307 |
ggctgttccggatgttaggttgaagattgagggtgttaaggatttggaggataagttggt |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29161889 |
ggctgttccggatgttaggttgaagattgagggggttaaggatttggaggataagttggt |
29161948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 183; E-Value: 2e-98
Query Start/End: Original strand, 547 - 745
Target Start/End: Original strand, 29162138 - 29162336
Alignment:
| Q |
547 |
gaatggtgaaatcgagagtggagtgttggtgagtaagaagaggaagaaaggagtgaaaaaagaggattatagtgagttgggaagtgtgaaatcattgaag |
646 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29162138 |
gaatggtgaaatcgagagtggagtgttggtgagtaagacggggaagaaaggagtcaaaaaagaggattctagtgagttgggaagtgtgaaatcattgaag |
29162237 |
T |
 |
| Q |
647 |
ggatctgctaagaggaagaagaaagatgggttggatgtgaagtctgcagaagaaggttcgattgagaacagtgaaaagaaaaagaagtcatccgtgaag |
745 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29162238 |
ggatctgctaagaggaagaagaaagatgggttggatgtgaagtctgcagaagaaggttcgattgagaacagtgaaaagaaaaagaagtcatccgtgaag |
29162336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 105; E-Value: 5e-52
Query Start/End: Original strand, 746 - 850
Target Start/End: Original strand, 29162361 - 29162465
Alignment:
| Q |
746 |
agcaaaaaggaattattggtcaaggatgagggttcggacaagaagaagagaaagacggcagatgtgaaggtcaagggtaagaaaagtaagaaggctctat |
845 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29162361 |
agcaaaaaggaattattggtcaaggatgagggttcggacaagaagaagagaaagacggcagatgtgaaggtcaagggtaagaaaagtaagaaggctctat |
29162460 |
T |
 |
| Q |
846 |
gatgt |
850 |
Q |
| |
|
||||| |
|
|
| T |
29162461 |
gatgt |
29162465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University