View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6978_low_33 (Length: 317)
Name: NF6978_low_33
Description: NF6978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6978_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 6e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 40447353 - 40447170
Alignment:
| Q |
1 |
attgcccaggtacaattttcatttgatttaggagtatgctatgaattatgattatgatactactttcgataaataaaaatgtcataaaatgtgttttagc |
100 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40447353 |
attgcccaggtacaatttt-----gatttagtagtatgctatgaattatgattatgatactactttcgataaataaaaatgtcataaaatgtgttttagc |
40447259 |
T |
 |
| Q |
101 |
aggagagggatatcgattcccttccttcagttggattgcatcaatttaggatgttcgcatatttgtggttg-tttgattgagattcaacgatt |
192 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40447258 |
aggagagggatatcgattcc----cttcagttggattgcatcaattcacgatgttcgcatatttgtggttgttttgattgagattcaacgatt |
40447170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 247 - 301
Target Start/End: Complemental strand, 40447115 - 40447061
Alignment:
| Q |
247 |
accgtcctatcttggtggaccgttcattgatgtgttgactacgaatataaaaatt |
301 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40447115 |
accgtcctatcttgatggaccgttcattgatgtgttgactacgaatagaaaaatt |
40447061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University