View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6978_low_36 (Length: 313)
Name: NF6978_low_36
Description: NF6978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6978_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 10 - 295
Target Start/End: Original strand, 41547078 - 41547363
Alignment:
| Q |
10 |
atggacatcacacaaataattggagcatgcaaacgtgaaaatgatatcaaaattaaacaagttcaatctagttagaggattactaaatatgaaatttaaa |
109 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41547078 |
atggatataacacaaataattggagcatgcaaacgtgaaaatgatatcaaaattaaacaagttcaatctagttagaggattactaaatatgaaatttaaa |
41547177 |
T |
 |
| Q |
110 |
tcaaatgtttttgcgaggcatatcaaaaagagaaacaaacatggacttcacattgtaaatgaccattggtagatgaacatatgggttaagcttcttttct |
209 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41547178 |
tcaaatgtttttgcgaggcatgtcaaaaagagaaacaaacatggacttcacattgtaaatgaccattggtagatgaacatatgggttaagcttctttact |
41547277 |
T |
 |
| Q |
210 |
acaaggatgattcatgcaccatgttcttcgtattctgcaaaaaagaaagtgtgtaaaatggaaaacatttttgtgtaacaacaatg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41547278 |
acaaggatgattcatgcaccatgttcttcgtattctgcaaaaaagaaagtgtgtaaaatggaaaacatttttgtgtaacaacaatg |
41547363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University