View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6978_low_37 (Length: 312)
Name: NF6978_low_37
Description: NF6978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6978_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 40548970 - 40549113
Alignment:
| Q |
1 |
tgataaacaattggtaatgcaataatttgtcacatcctcaatcgattgtaccgtatgtagtacagatgttagaatagaacgaaacatgcaactttacata |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40548970 |
tgataaacaatttgtaatgcaataatttgtcacatcctcaatcgattgtaccgtatgtagtacagatgttagaatagaacgaaacatgcaactttacata |
40549069 |
T |
 |
| Q |
101 |
aaaagtggtgcatattttttggtacataaattttggtataaatg |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40549070 |
aaaagtggtgcatattttttggtacataaattttggtataaatg |
40549113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 178 - 295
Target Start/End: Original strand, 40549146 - 40549259
Alignment:
| Q |
178 |
atcacatcatgtttcgtaactgactgcatatatatgtgatatactaagcttcaaaatctcaccatgttgaattttttaaacttaatattgacggttttta |
277 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40549146 |
atcacatcatgtttcgtaagtgactgcatat----gtgatatactaagcttcaaaatctcaccatgttgaattttttaaacttaatattgacggttttta |
40549241 |
T |
 |
| Q |
278 |
ccaagccttcgacatatc |
295 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
40549242 |
ccaagccttcgacatatc |
40549259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University