View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6978_low_49 (Length: 254)
Name: NF6978_low_49
Description: NF6978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6978_low_49 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 75 - 254
Target Start/End: Original strand, 32847862 - 32848041
Alignment:
| Q |
75 |
caggtcaactatggtgcacgtctcttaagttggttttgtatcattcattctttttcagtgttttctgcatgattaaacattaagccacagtcacggctta |
174 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32847862 |
caggtcaactatggtgcatgtctcttaagttggttttgtatcattcattctttttcagtgttttctgcatgattaaacattaagtcacagtcacggctta |
32847961 |
T |
 |
| Q |
175 |
gacatgtctttgatgacttgttatgtggaataactcacaatagatgcaagtggcacttttagatccacttgtttggttgc |
254 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32847962 |
gacatgtctttgacgacttgttatgtggaataactcacaatagatgcaagtggcacttttagatccacttgtttggttgc |
32848041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 13 - 47
Target Start/End: Original strand, 32847800 - 32847834
Alignment:
| Q |
13 |
gacatcacacctatgtaaaatgaaatgctattgtg |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32847800 |
gacatcacacctatgtaaaatgaaatgctattgtg |
32847834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 192 - 238
Target Start/End: Complemental strand, 31735331 - 31735283
Alignment:
| Q |
192 |
ttgttatgtggaataactcaca--atagatgcaagtggcacttttagat |
238 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31735331 |
ttgttatgtggaataactcacagtatagatgcaagtggcacttttagat |
31735283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University