View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6978_low_58 (Length: 229)
Name: NF6978_low_58
Description: NF6978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6978_low_58 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 18948394 - 18948622
Alignment:
| Q |
1 |
tcagaaagagcaatacattatatcattagttccatgtgagaaggaaaagggtggaagtgcagtagggttcatgactatttataaacagaaatgaagaaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18948394 |
tcagaaagagcaatacattatatcattagttccatgtgagaaggaaaagggtggaagtggagtagggttgatgactatttataaacagaaatgaagaaac |
18948493 |
T |
 |
| Q |
101 |
ttagttattaagatttttgaagtataaagtcgaatttcgttgcaagtttaagaaatgtgtgttttatgcacctaaaattatagtaattgtgtcttctatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
18948494 |
ttagttattaagatttttgaagtataaagtcgaatttcgttgcaagtttaagaaatgtgtgttttatgcaactaaatttatagtaattgcgtcttctatt |
18948593 |
T |
 |
| Q |
201 |
gatttttcgaaaatatatagtgtcctact |
229 |
Q |
| |
|
|||||||| |||||||||||||||||||| |
|
|
| T |
18948594 |
gatttttctaaaatatatagtgtcctact |
18948622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University