View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6978_low_66 (Length: 211)
Name: NF6978_low_66
Description: NF6978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6978_low_66 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 20 - 211
Target Start/End: Complemental strand, 33236588 - 33236397
Alignment:
| Q |
20 |
atcaaggaaaacaaacttaagaattagtctatgttatttatttatttttgccaaaatggcactaggtttaaagttcggatatctccccctttcaaagcac |
119 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33236588 |
atcaaggaaatcaaacttaagaattagtctatgttatttatttatttttgccaaaatggcactaggtttaaagttcggatatctcccccttccaaagcac |
33236489 |
T |
|
| Q |
120 |
atgagtaaccaaaccttgccaaaataatttcagaagtgattgttaacgtccactttaaaaggaagaaacagagacaaagacagaacaatgtc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33236488 |
atgagtaaccaaaccttgccaaaataatttcagaagtgattgttaacgtccactttaaaaggaagaaacagagacaaagacagaacaatgtc |
33236397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University