View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6979_high_8 (Length: 265)
Name: NF6979_high_8
Description: NF6979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6979_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 7 - 250
Target Start/End: Complemental strand, 42669249 - 42669002
Alignment:
| Q |
7 |
ggacatcaaatcaaaatactgagtagagcattaagaaataggaaatggaaaatagctgctatatccgatttaaaccaaaagcaccaccacaagagcaatt |
106 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42669249 |
ggacaacaaatcaaaatactgagtagagcgttaagaaataggaaatggaaaatagctgttatatccgatttaaaccaaaagcaccaccacaagagcaatt |
42669150 |
T |
|
| Q |
107 |
tcatctacaataaatctgtcggtaagattgtcacaatactagcatcataaatctcttcaagtacatgatatatg----nnnnnnnnnnnnaatttgatga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42669149 |
tcatctacaataaatctgtcggtaagattgtcacaatactagcatcataaatctcttcaagtacatgatatatgttttttttttttttttaatttgatga |
42669050 |
T |
|
| Q |
203 |
cttgcaacataaagtttgaaatttaatattgaggctacaaccagtgat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42669049 |
cttgcaacataaagtttgaaatttaatattgaggctacaaccagtgat |
42669002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University