View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6979_low_11 (Length: 240)
Name: NF6979_low_11
Description: NF6979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6979_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 12889098 - 12888862
Alignment:
| Q |
1 |
taatcttaacataggaaatcacaatgatttcaaatttcacatttatattaagccgtgcttgcttgcaatgttgaaaaatagcagccgtggtggagtgtcg |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||||||| |
|
|
| T |
12889098 |
taatcttaacataggaaatctcaatgatttcaaatttcacatttatattaagccgtgcttgcttgcaatgttggaaaatagtagtcgtggtggagtgtcg |
12888999 |
T |
 |
| Q |
101 |
tggtggatgatgtgccagccgctataggcaatttgtgcagggcacatggcatggcg-----atagatggcaattttggccatccgtcatacaccatcatc |
195 |
Q |
| |
|
||| |||||||||||||||||||| |||||||||||| |||||||||| ||||||| |||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
12888998 |
tggcggatgatgtgccagccgctacaggcaatttgtgaagggcacatgccatggcgacaccataggtggcagttttggccatccgtcgtacaccatcatc |
12888899 |
T |
 |
| Q |
196 |
taccatcctctactccaaacttgaaaattgtgatgtc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12888898 |
taccatcctctactccaaacttgaaaattgtggtgtc |
12888862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University