View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6979_low_11 (Length: 240)

Name: NF6979_low_11
Description: NF6979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6979_low_11
NF6979_low_11
[»] chr7 (1 HSPs)
chr7 (1-232)||(12888862-12889098)


Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 12889098 - 12888862
Alignment:
1 taatcttaacataggaaatcacaatgatttcaaatttcacatttatattaagccgtgcttgcttgcaatgttgaaaaatagcagccgtggtggagtgtcg 100  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |||||||||||||||    
12889098 taatcttaacataggaaatctcaatgatttcaaatttcacatttatattaagccgtgcttgcttgcaatgttggaaaatagtagtcgtggtggagtgtcg 12888999  T
101 tggtggatgatgtgccagccgctataggcaatttgtgcagggcacatggcatggcg-----atagatggcaattttggccatccgtcatacaccatcatc 195  Q
    ||| |||||||||||||||||||| |||||||||||| |||||||||| |||||||     |||| ||||| ||||||||||||||| ||||||||||||    
12888998 tggcggatgatgtgccagccgctacaggcaatttgtgaagggcacatgccatggcgacaccataggtggcagttttggccatccgtcgtacaccatcatc 12888899  T
196 taccatcctctactccaaacttgaaaattgtgatgtc 232  Q
    |||||||||||||||||||||||||||||||| ||||    
12888898 taccatcctctactccaaacttgaaaattgtggtgtc 12888862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University