View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6979_low_5 (Length: 341)
Name: NF6979_low_5
Description: NF6979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6979_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 9 - 323
Target Start/End: Original strand, 31607405 - 31607719
Alignment:
| Q |
9 |
tggtgttgcacaaaagatcgtcattctttcaaagtgtagatgatacattaggagtctttcacactcatgctgtggctggtattcttgggggaatcctttc |
108 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31607405 |
tggtgttgcacaaaaaatcaccattctttcaaagtgtagatgatacattaggagtctttcacactcatgctgtggctggtattcttgggggaatcctttc |
31607504 |
T |
|
| Q |
109 |
tggtgtgtttgccaaacctaaacttttgaggattctctatggtccttatgggtctggcttattgtatagttattttgatgataatataggtcaaggaatc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31607505 |
tggtgtgtttgccaaacctaaacttttgaggattctctatggtccttatgggtctggcttattgtatagttattttgatgataatataggtcaaggaatc |
31607604 |
T |
|
| Q |
209 |
aagcaaatgtggtaccaattattaggagcagtttttattactatttggaatgttgttattactagtctgatttgtattcttttaaatcgctttgtgaatc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31607605 |
aagcaaatgtggtaccaattattaggagcagtttttattactatttggaatgttgttattactagtctgatttgtattcttttaaatcgctttgtgaatc |
31607704 |
T |
|
| Q |
309 |
ttcgaatgcaagaag |
323 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
31607705 |
ttcgaatgcaagaag |
31607719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University