View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6979_low_8 (Length: 302)
Name: NF6979_low_8
Description: NF6979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6979_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 23904357 - 23904095
Alignment:
| Q |
1 |
ggtgttggattgttttgttgctgctgatgttgctctttgtgctgttttcaagtttgtgttagttcagttcacaggagcttgatttggttttgatttaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23904357 |
ggtgttggattgttttgttgctgctgatgttgctctttgtgctgttttcaagtttgtgttagttcagttcacaggagcttgatttggttttgatttaagg |
23904258 |
T |
|
| Q |
101 |
tacatttaattttaagcttttgaattcgtaatcattaatagtgaatttaagaatgctgttagaaatattggttttattctggaattgtctaattagaatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23904257 |
tacatttaattttaagcttttgaattcgtaatcattaatagtgaatttaagaatgctgttagaaatattgggtttattctggaattgtctaattagaatg |
23904158 |
T |
|
| Q |
201 |
gttgtgggattgggaatgacggtgtaggagtgttgagaagattgagtcaaaatcagttctact |
263 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23904157 |
gttgtgtgattgggaatgacggtgtaggagtgttgagaagattgagtcaaaatcagttctact |
23904095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 7 - 101
Target Start/End: Original strand, 3492224 - 3492314
Alignment:
| Q |
7 |
ggattgttttgttgctgctgatgttgctctttgtgctg-ttttcaagtttgtgttagttcagttcacaggagcttgatttggttttgatttaaggt |
101 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||| | ||||||||||| ||| ||||| | ||||||| ||||||||||||| ||||| |
|
|
| T |
3492224 |
ggattgttttgttgctgccggtgttgctctttgtgctgctcttcaagtttgtattaattcag-----aagagcttggtttggttttgattcaaggt |
3492314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University