View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6980_high_13 (Length: 226)
Name: NF6980_high_13
Description: NF6980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6980_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 7e-33; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 13 - 84
Target Start/End: Original strand, 15592640 - 15592711
Alignment:
| Q |
13 |
gagaagaaagtagcatgatgatattgataagcaagaaaatagaagatatcacccttggaagctaagctaggg |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15592640 |
gagaagaaagtagcatgatgatattgataagcaagaaaatagaagatatcacccttggaagctaagctaggg |
15592711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 15592779 - 15592837
Alignment:
| Q |
152 |
gtaattgttttggtattgaccttattagagatggatgatggctttggtgcggttggtgg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15592779 |
gtaattgttttggtattgaccttattagagatggatgatggctttggtgcggttggtgg |
15592837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 15682114 - 15682056
Alignment:
| Q |
152 |
gtaattgttttggtattgaccttattagagatggatgatggctttggtgcggttggtgg |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
15682114 |
gtaattgttttggtgctgaccttattagatattgatgatggctttggtgcggttggtgg |
15682056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University