View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6980_low_14 (Length: 226)

Name: NF6980_low_14
Description: NF6980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6980_low_14
NF6980_low_14
[»] chr5 (3 HSPs)
chr5 (13-84)||(15592640-15592711)
chr5 (152-210)||(15592779-15592837)
chr5 (152-210)||(15682056-15682114)


Alignment Details
Target: chr5 (Bit Score: 72; Significance: 7e-33; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 13 - 84
Target Start/End: Original strand, 15592640 - 15592711
Alignment:
13 gagaagaaagtagcatgatgatattgataagcaagaaaatagaagatatcacccttggaagctaagctaggg 84  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15592640 gagaagaaagtagcatgatgatattgataagcaagaaaatagaagatatcacccttggaagctaagctaggg 15592711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 15592779 - 15592837
Alignment:
152 gtaattgttttggtattgaccttattagagatggatgatggctttggtgcggttggtgg 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15592779 gtaattgttttggtattgaccttattagagatggatgatggctttggtgcggttggtgg 15592837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 15682114 - 15682056
Alignment:
152 gtaattgttttggtattgaccttattagagatggatgatggctttggtgcggttggtgg 210  Q
    ||||||||||||||  ||||||||||||| || ||||||||||||||||||||||||||    
15682114 gtaattgttttggtgctgaccttattagatattgatgatggctttggtgcggttggtgg 15682056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University