View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6980_low_15 (Length: 225)
Name: NF6980_low_15
Description: NF6980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6980_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 137 - 165
Target Start/End: Complemental strand, 15577971 - 15577943
Alignment:
| Q |
137 |
aataatacctaataaattgaacgtaacgt |
165 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15577971 |
aataatacctaataaattgaacgtaacgt |
15577943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University