View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6980_low_16 (Length: 214)
Name: NF6980_low_16
Description: NF6980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6980_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 195
Target Start/End: Original strand, 43255222 - 43255403
Alignment:
| Q |
17 |
gtgggactgactcttgtgattcggaggcgcgagcagataaatccagcaaaagaaagagccaaagccaaaccaaagttcattaaaattggcttcataccct |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43255222 |
gtgggactgactcttgtgattcggaggcgcgagcagataaatccagcaaaagaaagagccaaagccaaaccaaagttcactaaaattggcttcataccct |
43255321 |
T |
 |
| Q |
117 |
tctcttccttct---tcatcatcaaaattaatctaatttttcacaagataactaaaacagttcttcttcatcactatcatcc |
195 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43255322 |
tctcttccttcttcatcatcatcaaaattaatctaacttttcacaagataactaaaacagttcttcttcatcactatcatcc |
43255403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University