View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6981_high_22 (Length: 249)
Name: NF6981_high_22
Description: NF6981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6981_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 103 - 244
Target Start/End: Complemental strand, 6903860 - 6903717
Alignment:
| Q |
103 |
tgttgtttaagctcaaacacaacttgaagtgtctcaaacaaattgttataagttaatgaaagatattagaagctcgtgagagcaaatattttaccaaatg |
202 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6903860 |
tgttgtttaagctcaaacacaacttggagtgtctcaaacaaattgttataagctaatgaaagatattagaagctcgtgagagcaaatattttaccaaata |
6903761 |
T |
 |
| Q |
203 |
attataggttcaccgttcaaact--gaatattattcatctcact |
244 |
Q |
| |
|
| ||||| || ||| |||||||| ||||||||||||||||||| |
|
|
| T |
6903760 |
actatagttttaccattcaaacttcgaatattattcatctcact |
6903717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University