View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6982_high_13 (Length: 246)
Name: NF6982_high_13
Description: NF6982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6982_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 30 - 229
Target Start/End: Complemental strand, 8621326 - 8621126
Alignment:
| Q |
30 |
attttattgaaactcacatgttagaattgatatcataattagt-catttgtacaactaaaattttatcacagaattctttatttcttttgnnnnnnntgg |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
8621326 |
attttattgaaactcacatgttagaattgatatcataattagttcatttgtacaaataaaattttatcacagaactctttatttcttttgaaaaaaatgg |
8621227 |
T |
 |
| Q |
129 |
agatttggcctagatatataatctattcagtttgtaggattgaatgaaatttataaaactagtcagatatgtgtcttggtagcattcatatatgtggctt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8621226 |
agatttggcctagatatataatctattcagtttgtaggattgaattaaatttataaaactagtcagatatgtgtcttggtagcattcatatatgtggctt |
8621127 |
T |
 |
| Q |
229 |
g |
229 |
Q |
| |
|
| |
|
|
| T |
8621126 |
g |
8621126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University