View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6982_high_14 (Length: 244)
Name: NF6982_high_14
Description: NF6982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6982_high_14 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 28 - 244
Target Start/End: Complemental strand, 43638151 - 43637935
Alignment:
| Q |
28 |
actgtgttagtacttcatatatcttaattaacgattatctatttaagaattgcatttatcataaaatgatttttaccatacgattttataaatgattaaa |
127 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43638151 |
actgtgttagtacttaatatatcttaattaacgactatctatttaagaattgcatttatcataaaatgatttttaccatacgattttataaatgattaaa |
43638052 |
T |
|
| Q |
128 |
catgttattgtcacattggtttatcaatagttgtgggttgtgatgcattaatttatgcaggtgatgatttttggtgcacggacccagctggggatccaaa |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43638051 |
catgttattgtcacattggtttatcaatagttgtgggttgtgatgcattaatttatgcaggtgatgatttttggtgcacggacccagctggggatccaaa |
43637952 |
T |
|
| Q |
228 |
tggtacatattggttgc |
244 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43637951 |
tggtacatattggttgc |
43637935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 240
Target Start/End: Original strand, 488840 - 488895
Alignment:
| Q |
185 |
caggtgatgatttttggtgcacggacccagctggggatccaaatggtacatattgg |
240 |
Q |
| |
|
||||||||||||| |||||||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
488840 |
caggtgatgatttctggtgcactgacccatatggtgatccaaatggtacatattgg |
488895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University