View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6982_high_16 (Length: 223)
Name: NF6982_high_16
Description: NF6982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6982_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 7151241 - 7151023
Alignment:
| Q |
1 |
tagtagattagtcactgcttaatgaagtgggatacttattatctataacgtcgttgtctaaaaaa-gtagtcttcttaagtattgagattcgatctatca |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7151241 |
tagtagattagtcactgcttaatgaagtgggatacttattatctataacgtggttgtctaaaaaaagtagtcttcttaagtattgagattcgatctatca |
7151142 |
T |
 |
| Q |
100 |
tttgaaatgtgccatgctttaagctgaaatcgatattattcagttgtttaagaactgggttgctgccactg--------tttttattagtaatttccagt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7151141 |
tttgaaatgtgccatgctttaagctgaaatcgatattattcagttgtttaagaactgggttgctgccactgtttaactttttttattagtaatttccagt |
7151042 |
T |
 |
| Q |
192 |
aatatttactcgtgatgtc |
210 |
Q |
| |
|
||||||||||| ||||||| |
|
|
| T |
7151041 |
aatatttactcatgatgtc |
7151023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University