View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6982_high_7 (Length: 306)
Name: NF6982_high_7
Description: NF6982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6982_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 16 - 290
Target Start/End: Complemental strand, 28813725 - 28813431
Alignment:
| Q |
16 |
atcagtccactacaaacaagttaagaaggggaagaatatcaactacagaa-catgaattctgcccatttcca-------------------aagtaaatg |
95 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| || ||| ||||||||| |
|
|
| T |
28813725 |
atcagtccactacaaacaagtcaagaaggggaagaatatcaactacagaaccatgaattctgctttttaccaaatattctgctcattcttaaagtaaatg |
28813626 |
T |
 |
| Q |
96 |
ttcatattgcccccgcgtgagttaacttgcgacttacgctagtttcattcttacacttgacagcagctttcaaacatttctgtcttacactctcctgctt |
195 |
Q |
| |
|
| |||||| || |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28813625 |
tccatattacctccgcatgagttaacttgcgactcacgctagtttcattcttacacttgacagcagctttcaaacatttctgtcttacactctcctgctt |
28813526 |
T |
 |
| Q |
196 |
ctcatgttcttcttcttcctctctcatcttgaaactggaatcgaaatcattctctccaacctagaccagcatcctctcccatcaatcaagaaatt |
290 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28813525 |
ctcatgttcatcttcttcctctctcaccttgaaactggaatcgaaatcattctctccaacctagaccagcatcctctccaatcaatcaagaaatt |
28813431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 79 - 125
Target Start/End: Complemental strand, 9539125 - 9539079
Alignment:
| Q |
79 |
catttccaaagtaaatgttcatattgcccccgcgtgagttaacttgc |
125 |
Q |
| |
|
|||| ||||||||||||||||||||||||| || | ||||||||||| |
|
|
| T |
9539125 |
cattcccaaagtaaatgttcatattgcccctgcataagttaacttgc |
9539079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 84 - 122
Target Start/End: Complemental strand, 17797054 - 17797016
Alignment:
| Q |
84 |
ccaaagtaaatgttcatattgcccccgcgtgagttaact |
122 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
17797054 |
ccaaagtaaatgtccatattgcccctgcgtgagttaact |
17797016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 86 - 126
Target Start/End: Complemental strand, 38147112 - 38147072
Alignment:
| Q |
86 |
aaagtaaatgttcatattgcccccgcgtgagttaacttgcg |
126 |
Q |
| |
|
|||||||||||||||||| || | ||||||||||||||||| |
|
|
| T |
38147112 |
aaagtaaatgttcatattacctctgcgtgagttaacttgcg |
38147072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 86 - 126
Target Start/End: Original strand, 38225767 - 38225807
Alignment:
| Q |
86 |
aaagtaaatgttcatattgcccccgcgtgagttaacttgcg |
126 |
Q |
| |
|
||||||||||||||||||| | | ||||||||||||||||| |
|
|
| T |
38225767 |
aaagtaaatgttcatattgtctctgcgtgagttaacttgcg |
38225807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 81 - 126
Target Start/End: Original strand, 37576576 - 37576621
Alignment:
| Q |
81 |
tttccaaagtaaatgttcatattgcccccgcgtgagttaacttgcg |
126 |
Q |
| |
|
|||||||||||||||| |||||| |||| |||||||||||||||| |
|
|
| T |
37576576 |
tttccaaagtaaatgtccatattacccctacgtgagttaacttgcg |
37576621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 86 - 122
Target Start/End: Original strand, 42883146 - 42883182
Alignment:
| Q |
86 |
aaagtaaatgttcatattgcccccgcgtgagttaact |
122 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
42883146 |
aaagtaaatgttcatattgtccctgcgtgagttaact |
42883182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University