View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6982_low_10 (Length: 317)
Name: NF6982_low_10
Description: NF6982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6982_low_10 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 8 - 317
Target Start/End: Complemental strand, 8621646 - 8621338
Alignment:
| Q |
8 |
gatggacatcacaaatgattcaccaattgttggtcttgctggtggaaatctcgagacaccgtctgcgaaacaaagaggaagccgtgtgaagaacacacca |
107 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8621646 |
gatggacatgacaaatgattcaccaattgttggtcttgctggtggaaatctcgagacaccatctgcgaaacaaagaggaagtcgtgtgaagaacacacca |
8621547 |
T |
 |
| Q |
108 |
ggatctggtgaagccttgctgaggggtcaagtgaagacccttatgcagatggttgaagaagaggcttctcctcaaattcagagtctttctggtagtgtca |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8621546 |
ggatctggtgaagccttgctgaggggtcaagtgaagacccttatgcagatggttgaagaagaggcttctcctcaaattcagagtctttctggtagcgtca |
8621447 |
T |
 |
| Q |
208 |
ataatgcttctgttgctcaacaacattcaatttctcaggttcnnnnnnnnnatccctaaccaaagaaaaatgcatgaaatacattctttcttgttttctt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8621446 |
ataatgcttctgttgctcaacaacattcaatttctcaggttc-ttttttttatccctaaccaaagaaaaatgcatgaaatacattctttcttgttttctt |
8621348 |
T |
 |
| Q |
308 |
ttgttttgat |
317 |
Q |
| |
|
|||||||||| |
|
|
| T |
8621347 |
ttgttttgat |
8621338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 71 - 169
Target Start/End: Original strand, 32125612 - 32125710
Alignment:
| Q |
71 |
tgcgaaacaaagaggaagccgtgtgaagaacacaccaggatctggtgaagccttgctgaggggtcaagtgaagacccttatgcagatggttgaagaaga |
169 |
Q |
| |
|
|||||| |||||||||||||| |||||||| || || || ||||||||||| ||| ||||||| ||||||||||||||| |||||| ||||||||||| |
|
|
| T |
32125612 |
tgcgaagcaaagaggaagccgggtgaagaagactcctggttctggtgaagctttgttgaggggacaagtgaagacccttttgcagaaagttgaagaaga |
32125710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University